circad | circRNAs associated with diseases

Hsa_circ_0013958
Gene	ACP6	Organism	Human
Genome Locus	chr1:147131074-147131890:-	Build	hg19
Disease	Lung Adenocarcinoma	ICD-10	Malignant neoplasm of bronchus and lung (C34)
DBLink	Link to database	PMID	28685964
Experimental Method
Sample Type	Tissues, Cell lines and Plasma sample	Comparison	tumour and nontumour tissues
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GTTTGCTGGCTGGGCTTTTCC Reverse GGGACCTCTAATAGCTGGGGGTTC	Statistics	Fold Change : Upregulated pvalue : p<0.001
Citation
Zhu, X, Wang, X, Wei, S, Chen, Y, Chen, Y, Fan, X, Han, S, Wu, G (2017). hsa_circ_0013958: a circular RNA and potential novel biomarker for lung adenocarcinoma. FEBS J., 284, 14:2170-2182.